News for hackers. Stuff that matters.

A comment on Translate a nucleotide (DNA/RNA) sequence to a protein sequence.

Re:Translate a nucleotide (DNA/RNA) sequence to a protein se... by e0m on Wednesday November 20, 2013 @01:26PM (#6769903)
I re-posted this at https://news.ycombinator.com/item?id=6769875

CGCATTCCGTTTCGCGAAGATAGCGCGAACGGCGAACGC

It links directly to the Wolfram Alpha sequence, which more quickly illustrates what's hidden in this sequence.

[ Parent | on HN ]

There are no comments on this comment yet.